|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Biology, The Johns Hopkins University, Baltimore, Maryland 21218, USA
Reprint requests to: Karen L. Beemon, Ph.D, Department of Biology, Johns Hopkins University, 3400 North Charles Street, Baltimore, MD 21218, USA; e-mail: KLB{at}jhu.edu; fax: (410) 516-7292; phone: (410) 516-7289.
| ABSTRACT |
|---|
|
|
|---|
Keywords: NMD; RNA surveillance; translation termination; Rous sarcoma virus
| INTRODUCTION |
|---|
|
|
|---|
Conversely, in yeast very few genes contain introns (Lopez and Seraphin 2000
), and these unspliced mRNAs readily undergo NMD in a Upf-dependent fashion (Hilleren and Parker 1999
; Gonzalez et al. 2001
). This decay appears to be directed either by a coding region destabilizing element or distance from the poly(A) tail (for review, see Hilleren and Parker 1999
). Recent experiments in which the poly(A) binding protein was tethered downstream of a PTC resulted in stabilization of the NMD substrate (Amrani et al. 2004
).
In contrast to the paradigm in mammalian cells that NMD is linked to splicing, Rous sarcoma virus (RSV) RNA undergoes NMD in chicken cells in the absence of splicing (Barker and Beemon 1991
, 1994
; LeBlanc and Beemon 2004
). The 9.3-kb unspliced viral RNA is exported to the cytoplasm where it serves as both the genome of progeny virions and the mRNA template for the Gag and the Gag-Pol polyproteins (Swanstrom and Wills 1997
). In most cases, only the first gene, gag, is translated, resulting in a 7-kb 3' untranslated region (UTR) (Fig. 1A
). Approximately 5% of the time, a 1 programmed ribosomal frameshift moves the ribosome into the reading frame of the second viral gene, pol, resulting in synthesis of a Gag-Pol fusion protein (Swanstrom and Wills 1997
). Barker and Beemon (1991
, (1994
) reported that premature termination codons (PTCs) in the gag gene lead to a substantial decrease in unspliced cytoplasmic viral RNA. This decay diminishes gradually when the PTC is in the final 150 nt of the gag gene, approaching the natural termination codon (Barker and Beemon 1994
). Additionally, LeBlanc and Beemon (2004)
showed that this decay depends on translation and the critical NMD factor Upf1, implicating the NMD machinery. Since this regulation occurs on an unspliced RNA, it contrasts with previous reports in higher eukaryotes that splicing is necessary to distinguish a PTC from a normal termination codon (Maquat 2004
).
|
| RESULTS |
|---|
|
|
|---|
Toward this end, we used the 10.8 viral construct, a clone of the Prague C strain of RSV, harboring a deletion in the nucleocapsid region of the gag gene (Meric et al. 1988
). This deletion prevents packaging of the viral unspliced RNA. Barker and Beemon (1994
) reported that a termination codon placed early in the pol gene (nt 2598) had no substantial effect on unspliced RNA stability. However, this could be due to the infrequent 1 frameshift, which leads to infrequent translation of the pol gene. To address the question of whether engineered termination codons throughout pol cause NMD, we constructed the plasmid 10.8 +1; 10.8 +1 contains a single adenine insertion at nt 2482, immediately upstream of the gag natural termination codon. This insertion places gag and pol in the same reading frame, ensuring efficient translation of the Gag-Pol fusion polypeptide (Fig. 1A
). We then made a series of constructs, each possessing a termination codon within the pol gene, in either the 10.8 or the 10.8 +1 background (Fig. 1A
). CEF cells were transiently transfected with the above constructs, and 2-d post-transfection protein and RNA were harvested.
A Western blot using anti-p19 (Matrix) antibody to detect RSV Gag proteins showed that the majority of protein translated from the 10.8 transcript was the Gag protein, Pr76gag, with a smaller amount of Pr180gagpol readthrough product (Fig. 1B
, lane 2). In contrast, translation of 10.8 +1 RNA led to production of only the Gag-Pol polyprotein, Pr180gagpol (Fig. 1B
, lane 3). As predicted, truncated read-through protein products (denoted by an *) of approximately 78, 123, and 154 kDa were observed when a PTC was placed within the pol gene at nt 2533, 3739, and 4618, respectively (Fig. 1B
, lanes 49).
We next assayed the relative levels of unspliced RNA transcribed from each of the constructs bearing a PTC in pol by an RNase protection assay (Fig. 2
). We cotransfected a stable viral loading control, and then probed the sample using a viral gag probe that can distinguish between the two viral RNAs (LeBlanc and Beemon 2004
). We found that the 10.8 +1 transcript, which terminates translation at the end of pol, only accumulated 66% as much RNA as the 10.8 wild-type construct (Fig. 2
, lanes 1,2). Interestingly, RNA bearing a termination codon at nt 2533, ~ 50 nt downstream of the gag natural termination codon, accumulated at wild-type levels in both the 10.8 and the 10.8 +1 constructs (Fig. 2
, lanes 3,4). In contrast, termination codons placed further downstream, at nt 3004, 3739, and 4618 in the pol gene, led to RNA accumulation at the wild-type level in the 10.8 background (Fig. 2
, lanes 5,7,9). However, only 23%38% as much RNA as wild type accumulated in the 10.8 +1 background (Fig. 2
, lanes 6,8,10). This experiment suggests that PTCs in pol that are infrequently translated do not induce NMD. However, when readthrough from gag is efficient, these same PTCs now cause a lower level of the unspliced RNA. The observation that RNA bearing a PTC just downstream of the gag natural termination codon still accumulated to high levels in the 10.8 +1 context (Fig. 2
, lane 4) led us to examine this region more closely.
|
We tested this hypothesis by deleting the putative RSV stability element (RSE) (nt 24862886) immediately after the natural termination codon in the 10.8 context, to generate the construct
RSE (Fig. 3A
). After transient transfection in CEFs, the amount of viral RNA generated was assayed by RNase protection and found to be about fourfold less abundant than wild-type 10.8 RNA (Fig. 3B
). This reduced level of viral RNA was similar to that seen previously with viral RNAs containing a termination codon in gag (LeBlanc and Beemon 2004
). The previous observation that RNAs with PTCs in the last 150 nt of the gag gene, near the RSE, are increasingly more abundant than RNAs with PTCs in the rest of the gag gene should be noted (Barker and Beemon 1994
).
|
RSE construct was due to the NMD pathway, we tested its dependence on translation and the protein Upf1, both previously shown to be required for NMD (Leeds et al. 1991
RSE construct (Fig. 3C
We also blocked NMD by co-transfection of a dominant negative mutant of hUpf1, RR857GA (Mendell et al. 2002
). When the Upf1 mutant was co-transfected with
RSE, we saw a twofold increase in the unspliced RNA level, normalized to 10.8 RNA in each experiment (Fig. 3D
). In the same experiment, we saw a similar increase in the amount of a viral RNA bearing a PTC at nt 1924 (Ter) (Barker and Beemon 1994
). Co-transfection with either wild-type Upf1 or RR857GA caused no significant change in the level of the control 10.8 RNA to which the mutants are standardized. We conclude that deletion of this 3' UTR region, the RSE, causes the natural termination codon to behave like a PTC.
The RSE can stabilize a PTC in gag
Since the wild-type RNA has the RSE downstream of the natural termination codon, we examined the effect of placing the RSE downstream of a PTC in the gag gene. To test this, we used the Ter construct with a PTC at nt 1924 in gag (Fig. 4A
; Barker and Beemon 1994
). The unspliced RNA from this PTC-containing RNA accumulated at 19% of wild-type RNA levels (Fig. 4A
, lane 1). We then made a deletion in the gag gene, immediately downstream of the PTC insertion, extending to the natural termination codon. This deletion effectively positioned the RSE immediately downstream of the PTC. RNA from this construct accumulated to ~ 62% of the wild-type level (Fig. 4A
, lane 4). Subsequent deletion of the RSE from this construct resulted in decreased RNA levels (27% of wild type) (Fig. 4A
, lane 5), further implicating the RSE in stabilization.
|
RSE). We observed approximately wild-type levels of unspliced RNA with the forward, but not the reverse insertion, suggesting that this element can stabilize the RNA with a termination codon at nt 1250 (Fig. 4B
To ask whether the observed decrease in RNA level was due to RNA instability, we used the drug actinomycin D to inhibit bulk cellular transcription in CEFs transiently transfected with 10.8, Ter (1924) (Fig. 4A
), Ter for
RSE, and Ter rev
RSE (Fig. 4B
). We then harvested RNA at 0-, 1-, 2-, and 4-h time points after addition of the drug. Representative gels are shown in Figure 5A
. RNA levels at each time point were quantitated and plotted in Figure 5B
, relative to the RNA level of each construct at zero time. We found that RNA bearing a PTC in gag followed by the RSE in the sense orientation (Ter for
RSE) was as stable as wild-type RNA. However, RNAs bearing the PTC alone (Ter) or with a PTC followed by the RSE in the reverse orientation (Ter rev
RSE) were both much less stable, with the RNA level dropping off rapidly during the first hour, and then stabilizing between 2 and 4 h. From this result we can conclude that the RSE is affecting RNA abundance at the level of RNA stability.
|
|
| DISCUSSION |
|---|
|
|
|---|
Different organisms have developed alternative mechanisms of NMD
NMD was first observed in yeast (Losson and Lacroute 1979
), where it requires both translation and the Upf proteins, just as it does in eukaryotic cells. In yeast, only about 4% of genes are spliced (Lopez and Seraphin 2000
), and the identification of PTCs does not require splicing (Gonzalez et al. 2001
). Recent work in yeast suggests that this organism differentiates premature from normal termination events by a faux UTR model (Amrani et al. 2004
). This model posits that the natural termination codon is identified by its proximity to an appropriate 3' UTR and termination stabilizing factors. Conversely, the region downstream of a PTC within the coding region is a "faux" (or false) UTR, which is unfit to direct proper termination (Hilleren and Parker 1999
). Jacobson and coworkers (Amrani et al. 2004
) have shown that translation termination at a PTC is aberrant, and the ribosome does not properly release from the RNA. A natural 3' UTR can promote proper termination, as can tethered poly(A) binding protein. This challenges a previous model in yeast that suggests the existence of a cis-acting exonic downstream sequence element (DSE) (Ruiz-Echevarria et al. 1998
; Gonzalez et al. 2000
).
Some notable exceptions to the generally accepted NMD model exist (Enssle et al. 1993
; Barker and Beemon 1994
; Carter et al. 1996
; Zhang et al. 1998b
; Gudikote and Wilkinson 2002
; Wang et al. 2002
; LeBlanc and Beemon 2004
). In mammalian cells, a mark deposited by a prior splicing event downstream of a termination codon appears to signal premature termination. Thus, an RNA without an intron downstream of a PTC should be immune to NMD (Maquat and Li 2001
; Brocke et al. 2002
). However, a loosely characterized "failsafe signal" in globin mRNA acts to direct NMD even in the absence of a downstream intron (Zhang et al. 1998b
). Similarly, we have observed that a viral mRNA undergoes NMD in chicken cells in the absence of splicing, thus it does not conform to the rules established for NMD in mammalian and, presumably, other higher eukaryotic cells. Izaurralde and coworkers (Gatfield et al. 2003
) first highlighted differences between mammals and other metazoans by showing that knockdown of several key EJC components had no effect on NMD, and PTC discrimination appears to be independent of exonexon boundaries in Drosophila. Our observations are similar to this work in Drosophila in that we observe splicing-independent NMD in chicken cells. Like mammals, chickens utilize extensive mRNA splicing (Hillier et al. 2004
).
Possible NMD mechanisms for RSV RNA
We have observed that a PTC in the pol gene elicits decay only when translated efficiently, suggesting that PTC recognition during any round of translation does not induce NMD. Similarly, it has been proposed that in mammalian cells, NMD occurs only during a pioneer round of translation (Lejeune et al. 2004
). In contrast, studies in both yeast and rats have shown a decrease in RNA levels due to an infrequently translated PTC (Buzina and Shulman 1999
; Plant et al. 2004
). This is not surprising since RNAs in yeast can undergo NMD during any round of translation (Maderazo et al. 2003
). Further, the RNA tested in rats was Ig-µ (Buzina and Shulman 1999
), a transcript that seems to require special NMD rules (Buhler et al. 2004
, 2005
).
Similar to experiments in yeast where a 3' UTR was used to stabilize a PTC (Amrani et al. 2004
), we used various deletions and insertions to position the RSE immediately downstream of a PTC in the gag gene. In all cases, the RSE showed sequence-specific stabilization of the RNA. In yeast, poly(A) binding protein tethered downstream of a PTC caused stabilization. It therefore seems plausible that a feature of the correct 3' UTR may involve proximity to the poly(A) tail or its associated factors such as the eRFs. However, when we moved the proper gag 3' UTR (the RSE) immediately after a PTC, the poly(A) tail was still about 7 kb away. It is conceivable that the RSE itself interacts with factors that recruit the eRFs. Alternatively, this region may help the viral unspliced RNA overcome an extremely long 3' UTR, possibly by promoting long-range interactions with distant parts of the transcript. Without this stability element, the untranslated region following a termination codon is seen as aberrant by the cell and undergoes decay.
An alternative hypothesis is that there is a DSE in the coding region of RSV, as proposed in yeast (Zhang et al. 1995
). A DSE-like sequence might be found in the RSV coding region, potentially binding EJC proteins, SR proteins, or other potential RNA decay triggering factors such as the recently identified protein Staufen 1 (Lykke-Andersen et al. 2000
; Zhang and Krainer 2004
; Kim et al. 2005
). Also, it is arguable that the deletion analysis we carried out (Fig. 4A
) may be changing the distance between the termination codon and a downstream DSE. However, we observed stabilization of the PTC- bearing RNA only by a sense insertion of the RSE (Fig. 4B
). If we were simply moving a DSE too far away, then the anti-sense insertion would be predicted to stabilize the RNA in the same fashion. Thus, it appears that the stabilization is due to specific sequences within the RSE, which may recruit positive stability factors or repel negative decay factors.
Conserved 3' UTR motifs may play a role in stabilizing natural termination events
A recent report aligned untranslated portions of many annotated genes from human, rat, mouse, and dog (Xie et al. 2005
). Several conserved motifs were found in both the promoter regions of genes and the 3' UTRs of these genes. In addition to an enriched pool of predicted eight-mer miRNA target sites, conserved motifs were found in the 3' UTR. Although several of these motifs have a known function (poly(A) site, AU rich elements), most of the 3' UTR motifs have no identified function. Perhaps some of these unknown motifs are involved in stabilization of a natural termination codon. The RSE sequence contains similarities to some of the 3' UTR motifs, which overlap our 3' set of mutations. Future experiments will be designed to dissect the region containing these point mutations and to ask whether they disrupt common termination-stabilizing motifs.
Implications
A recent report describes up-regulation of human endogenous retroviral RNAs when Upf1 is knocked down by RNAi in human cells (Mendell et al. 2004
). It appears that the NMD pathway may be keeping these viral RNAs in check, even though most of the coding regions lack downstream introns (Bohne et al. 2005
). The observation that inactivation of NMD affects transcripts from human endogenous retroviruses suggests that they may undergo NMD in human cells in a manner similar to the decay of avian retroviral transcripts in chicken cells.
Perhaps as higher organisms evolved the formation of an EJC, this became the primary signal that a termination codon was a PTC. Chicken and Drosophila, although possessing EJC protein genes, may not require the EJC to promote NMD. Thus far all of the work probing the composition of the EJC has been done in human cells. These other organisms may be relying on an ancient, alternate mechanism to direct NMD. It has recently been suggested that different organisms have evolved mechanisms of PTC determination best suited for the amount and type of pre-mRNA processing that each one utilizes (Tange et al. 2004
; Conti and Izaurralde 2005
; Lejeune and Maquat 2005
). Our identification of the cis-acting RSE sequence helps to close the gap in the understanding of how NMD works in different organisms. Due to its important role in viral replication, the full-length RSV RNA is unspliced, exported from the nucleus, and translated, while bearing a 7-kb 3' UTR. The RSE may have evolved in order to help the virus overcome the RNA destabilization from such a long 3' UTR. Understanding how this works may help us realize why transcripts with extended 3' UTRs are NMD substrates (Hilleren and Parker 1999
) and eventually develop a better understanding of the mechanism of NMD.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The
RSE construct contains a deletion of nt 24862886. This was generated by inverse PCR from 10.8, using the following primers;
401F 5'-CTCCCCTCTGTGAATAACCAGGCCCCC GC-3' and
401R 5'-CTATAAATTTGTCAAGCGGAGCCCTA GCC-3'. The primers were kinased using T4 polynucleotide kinase (NEB) and used in a touchdown PCR reaction.
The Ter
gag construct was created using the plasmid 1924T described previously (Barker and Beemon 1994
). 1924T contains a linker, with stop codons in all three reading frames, inserted at the SmaI site at nt 1924. Nucleotides 1934 (immediately after the in frame PTC) through 2485 (up to and including the gag stop codon) were deleted by inverse PCR as described above, using the following primers: 2486for 5'-GGGAGGGCCACTGTTCTCCTGTTGCGC-3', and KTreverse - 5'-CTAGACTAGCGGGGATCCACAAGTGTAGCAG AGCCC-3'. Construct Ter
gag
RSE was made by inverse PCR using primers KTreverse and
401F described above. This construct has a deletion extending from nt 19342887. Construct 1547C (loading control) is a similar construct with a control insertion (no PTCs) at nt 1547 (Barker and Beemon 1994
). The different sites of linker insertion led to two different products upon RNase digestion of the complementary riboprobe (LeBlanc and Beemon 2004
).
To make the constructs Ter for/rev, the RSE sequence (nt 24832887) was amplified by PCR from the 10.8 plasmid template, using primers possessing AatII sites at their 5' ends. These PCR fragments were cloned into the unique AatII site at nt 1250 in both the forward and reverse orientations. The natural gag termination codon is present at the 5' end of the RSE forward fragment. A termination codon was also introduced at the 5' end of the RSE in the reverse orietation. Ter
RSE for/rev were made in the same fashion and cloned into the
RSE background. Fragments A, B, C, or D were made by PCR, and inserted at the same site. Each fragment begins with a TAG stop codon and then encompasses the following sequences: (A) 24862735, (B) 26002735, (C) 26002880, (D) 26172706. Note, fragment C ends 7 nt before the end of the full-length RSE.
The construct C mutant contains the same insertion as C above, with a series of point mutations. The mutagenic primers used to make this fragment are: MutCfor 5'-GCGCGGACGTCTAGCGC TAACGCAATTAGTGGAAAAAGATAAAGCGTTAGGACATATAG AACC-3', and MutCrev 5'-GCGGACGTCTAGTAATAGGTCAA CACCTTGAGGTCTAAG-3', with the underlined nt mutated from the wild-type sequence. The 3' end of this fragment ends at the same nt as the 3' end of the full-length RSE.
RNA isolation and RNase protection assays
In vitro transcription of the RSV gag probe was carried out as described in LeBlanc and Beemon (2004)
. RNA isolation and RNase protection assays were done as described previously (LeBlanc and Beemon 2004
). In brief, total cellular RNA was harvested 4048 h after transfection, using RNA-Bee (Tel-Test) per the manufacturers instructions. After hybridization with 250,000 cpm of probe, RNA was digested with 10 U/mL RNase T1 (Calbiochem) and 5 µg/mL RNase A at 34°C. After 45 min the digestion was stopped by addition of sodium dodecyl sulfate and Proteinase K (Roche) and incubated at 37°C for 15 min. RNA was extracted with phenol: chloroform: iso-amyl alcohol, precipitated with ethanol, and resuspended in 8 M urea loading buffer, and denatured for 5 min at 95°C. Samples were loaded onto a 6% acrylamide, 8 M urea gel, and electrophoresed at 60W for 24 h. RNA levels were quantified using either an Instant Imager (Packard), or a Typhoon 9410 PhosphorImager (Amersham).
Cell culture and transfection
Cell culture and transfection of secondary CEF cells were carried out as described in LeBlanc and Beemon (2004)
. Transfections were carried out in 60-mm plates that were 90%95% confluent. Anisomycin (Calbiochem) was used at a final concentration of 25 µg/mL to inhibit cellular translation. Actinomycin D (Calbiochem) was used at a final concentration of 2 µg/mL to inhibit cellular transcription.
Western blot analysis
CEF cells were removed from the plates at 39°C with 0.05% trypsin-EDTA (Gibco) and pelleted. Western blotting was carried out as described in LeBlanc and Beemon (2004)
. RSV Gag and Gag-Pol proteins were detected using polyclonal rabbit anti-avian myelobastosis virus (AMV) p19gag serum, obtained from D.P. Bolognesi (Duke University), and ImmunoPure goat anti-rabbit Immunoglobulin G (heavy plus light chains, horseradish peroxidase conjugated; Pierce). Blots were then visualized by autoradiography using the enhanced chemiluminescence reagent kit (Amersham).
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Received June 2, 2005; accepted October 10, 2005.
| REFERENCES |
|---|
|
|
|---|
Amrani, N., Ganesan, R., Kervestin, S., Mangus, D.A., Ghosh, S., and Jacobson, A. 2004. A faux 3'-UTR promotes aberrant termination and triggers nonsense-mediated mRNA decay. Nature 432: 112118.[CrossRef][Medline]
Barker, G.F. and Beemon, K. 1991. Nonsense codons within the Rous sarcoma virus gag gene decrease the stability of unspliced viral RNA. Mol. Cell. Biol. 11: 27602768.
. 1994. Rous sarcoma virus RNA stability requires an open reading frame in the gag gene and sequences downstream of the gag-pol junction. Mol. Cell. Biol. 14: 19861996.
Belgrader, P., Cheng, J., and Maquat, L.E. 1993. Evidence to implicate translation by ribosomes in the mechanism by which nonsense codons reduce the nuclear level of human triosephosphate isomerase mRNA. Proc. Natl. Acad. Sci. 90: 482486.
Bohne, J., Wodrich, H., and Krausslich, H.G. 2005. Splicing of human immunodeficiency virus RNA is position-dependent suggesting sequential removal of introns from the 5' end. Nucleic Acids Res. 33: 825837.
Brocke, K.S., Neu-Yilik, G., Gehring, N.H., Hentze, M.W., and Kulozik, A.E. 2002. The human intronless melanocortin 4-receptor gene is NMD insensitive. Hum. Mol. Genet. 11: 331335.
Buhler, M., Paillusson, A., and Muhlemann, O. 2004. Efficient down-regulation of immunoglobulin mu mRNA with premature translation-termination codons requires the 5'-half of the VDJ exon. Nucleic Acids Res. 32: 33043315.
Buhler, M., Mohn, F., Stalder, L., and Muhlemann, O. 2005. Transcriptional silencing of nonsense codon-containing immunoglobulin minigenes. Mol. Cell 18: 307317.[CrossRef][Medline]
Buzina, A. and Shulman, M.J. 1999. Infrequent translation of a nonsense codon is sufficient to decrease mRNA level. Mol. Biol. Cell 10: 515524.
Carter, M.S., Doskow, J., Morris, P., Li, S., Nhim, R.P., Sandstedt, S., and Wilkinson, M.F. 1995. A regulatory mechanism that detects premature nonsense codons in T-cell receptor transcripts in vivo is reversed by protein synthesis inhibitors in vitro. J. Biol. Chem. 270: 2899529003.
Carter, M.S., Li, S., and Wilkinson, M.F. 1996. A splicing-dependent regulatory mechanism that detects translation signals. EMBO J. 15: 59655975.[Medline]
Chan, C.C., Dostie, J., Diem, M.D., Feng, W., Mann, M., Rappsilber, J., and Dreyfuss, G. 2004. eIF4A3 is a novel component of the exon junction complex. RNA 10: 200209.
Conti, E. and Izaurralde, E. 2005. Nonsense-mediated mRNA decay: Molecular insights and mechanistic variations across species. Curr. Opin. Cell Biol. 17: 316325.[CrossRef][Medline]
Enssle, J., Kugler, W., Hentze, M.W., and Kulozik, A.E. 1993. Determination of mRNA fate by different RNA polymerase II promoters. Proc. Natl. Acad. Sci. 90: 1009110095.
Gatfield, D., Unterholzner, L., Ciccarelli, F.D., Bork, P., and Izaurralde, E. 2003. Nonsense-mediated mRNA decay in Drosophila: At the intersection of the yeast and mammalian pathways. EMBO J. 22: 39603970.[CrossRef][Medline]
Gonzalez, C.I., Ruiz-Echevarria, M.J., Vasudevan, S., Henry, M.F., and Peltz, S.W. 2000. The yeast hnRNP-like protein Hrp1/Nab4 marks a transcript for nonsense-mediated mRNA decay. Mol. Cell 5: 489499.[CrossRef][Medline]
Gonzalez, C.I., Bhattacharya, A., Wang, W., and Peltz, S.W. 2001. Nonsense-mediated mRNA decay in Saccharomyces cerevisiae. Gene 274: 1525.[CrossRef][Medline]
Gudikote, J.P. and Wilkinson, M.F. 2002. T-cell receptor sequences that elicit strong down-regulation of premature termination codon-bearing transcripts. EMBO J. 21: 125134.[CrossRef][Medline]
He, F. and Jacobson, A. 2001. Upf1p, Nmd2p, and Upf3p regulate the decapping and exonucleolytic degradation of both nonsense-containing mRNAs and wild-type mRNAs. Mol. Cell. Biol. 21: 15151530.
Hilleren, P. and Parker, R. 1999. Mechanisms of mRNA surveillance in eukaryotes. Annu. Rev. Genet. 33: 229260.[CrossRef][Medline]
Hillier, L.W., Miller, W., Birney, E., Warren, W., Hardison, R.C., Ponting, C.P., Bork, P., Burt, D.W., Groenen, M.A., Delany, M.E., et al. 2004. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution. Nature 432: 695716.[CrossRef][Medline]
Kim, V.N., Kataoka, N., and Dreyfuss, G. 2001a. Role of the nonsense-mediated decay factor hUpf3 in the splicing-dependent exonexon junction complex. Science 293: 18321836.
Kim, V.N., Yong, J., Kataoka, N., Abel, L., Diem, M.D, and Dreyfuss, G. 2001b. The Y14 protein communicates to the cytoplasm the position of exonexon junctions. EMBO J. 20: 20622068.[CrossRef][Medline]
Kim, Y.K., Furic, L., Desgroseillers, L., and Maquat., L.E. 2005. Mammalian Staufen1 recruits Upf1 to specific mRNA 3' UTRs so as to elicit mRNA decay. Cell 120: 195208.[CrossRef][Medline]
Le Hir, H., Izaurralde, E., Maquat, L.E., and Moore, M.J. 2000a. The spliceosome deposits multiple proteins 2024 nucleotides upstream of mRNA exon-exon junctions. EMBO J. 19: 68606869.[CrossRef][Medline]
Le Hir, H., Moore, M.J., and Maquat, L.E. 2000b. Pre-mRNA splicing alters mRNP composition: Evidence for stable association of proteins at exon-exon junctions. Genes & Dev. 14: 10981108.
Le Hir, H., Gatfield, D., Braun, I.C., Forler, D., and Izaurralde, E. 2001. The protein Mago provides a link between splicing and mRNA localization. EMBO Rep. 2: 11191124.[CrossRef][Medline]
LeBlanc, J.J. and Beemon, K.L. 2004. Unspliced Rous sarcoma virus genomic RNAs are translated and subjected to nonsense-mediated mRNA decay before packaging. J. Virol. 78: 51395146.
Leeds, P., Peltz, S.W., Jacobson, A., and Culbertson, M.R. 1991. The product of the yeast UPF1 gene is required for rapid turnover of mRNAs containing a premature translational termination codon. Genes & Dev. 5: 23032314.
Lejeune, F. and Maquat, L.E. 2005. Mechanistic links between nonsense-mediated mRNA decay and pre-mRNA splicing in mammalian cells. Curr. Opin. Cell Biol. 17: 309315.[CrossRef][Medline]
Lejeune, F., Ranganathan, A.C., and Maquat, L.E. 2004. eIF4G is required for the pioneer round of translation in mammalian cells. Nat. Struct. Mol. Biol. 11: 9921000.[CrossRef][Medline]
Lewis, B.P., Green, R.E., and Brenner, S.E. 2003. Evidence for the widespread coupling of alternative splicing and nonsense-mediated mRNA decay in humans. Proc. Natl. Acad. Sci. 100: 189192.
Lopez, P.J. and Seraphin, B. 2000. YIDB: The Yeast Intron DataBase. Nucleic Acids Res. 28: 8586.
Losson, R. and Lacroute, F. 1979. Interference of nonsense mutations with eukaryotic messenger RNA stability. Proc. Natl. Acad. Sci. 76: 51345137.
Lykke-Andersen, J. 2002. Identification of a human decapping complex associated with hUpf proteins in nonsense-mediated decay. Mol. Cell. Biol. 22: 81148121.
Lykke-Andersen, J., Shu, M.D., and Steitz, J.A. 2000. Human Upf proteins target an mRNA for nonsense-mediated decay when bound downstream of a termination codon. Cell 103: 11211131.[CrossRef][Medline]
Maderazo, A.B., Belk, J.P., He, F., and Jacobson, A. 2003. Nonsense-containing mRNAs that accumulate in the absence of a functional nonsense-mediated mRNA decay pathway are destabilized rapidly upon its restitution. Mol. Cell. Biol. 23: 842851.
Maquat, L.E. 2004. Nonsense-mediated mRNA decay: Splicing, translation and mRNP dynamics. Nat. Rev. Mol. Cell Biol. 5: 8999.[CrossRef][Medline]
Maquat, L.E. and Li, X. 2001. Mammalian heat shock p70 and histone H4 transcripts, which derive from naturally intronless genes, are immune to nonsense-mediated decay. RNA 7: 445456.[Abstract]
Mendell, J.T., ap Rhys, C.M., and Dietz, H.C. 2002. Separable roles for rent1/hUpf1 in altered splicing and decay of nonsense transcripts. Science 298: 419422.
Mendell, J.T., Sharifi, N.A., Meyers, J.L., Martinez-Murillo, F., and Dietz, H.C. 2004. Nonsense surveillance regulates expression of diverse classes of mammalian transcripts and mutes genomic noise. Nat. Genet. 36: 10731078.[CrossRef][Medline]
Meric, C., Gouilloud, E., and Spahr, P.F. 1988. Mutations in Rous sarcoma virus nucleocapsid protein p12 (NC): Deletions of Cys-His boxes. J. Virol. 62: 33283333.
Neu-Yilik, G., Gehring, N.H., Hentze, M.W., and Kulozik, A.E. 2004. Nonsense-mediated mRNA decay: From vacuum cleaner to Swiss army knife. Genome Biol. 5: 218.[CrossRef][Medline]
Plant, E.P., Wang, P., Jacobs, J.L., and Dinman, J.D. 2004. A programmed 1 ribosomal frameshift signal can function as a cis-acting mRNA destabilizing element. Nucleic Acids Res. 32: 784790.
Ruiz-Echevarria, M.J., Gonzalez, C.I., and Peltz, S.W. 1998. Identifying the right stop: Determining how the surveillance complex recognizes and degrades an aberrant mRNA. EMBO J. 17: 575589.[CrossRef][Medline]
Sun, X., Moriarty, P.M., and Maquat, L.E. 2000. Nonsense-mediated decay of glutathione peroxidase 1 mRNA in the cytoplasm depends on intron position. EMBO J. 19: 47344744.[CrossRef][Medline]
Swanstrom, R. and Wills, J.W. 1997. Synthesis, assembly, and processing of viral proteins. In Retroviruses (eds. J.M. Coffin et al.), pp. 263334. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Tange, T.O., Nott, A., and Moore, M.J. 2004. The ever-increasing complexities of the exon junction complex. Curr. Opin. Cell Biol. 16: 279284.[CrossRef][Medline]
Wang, J., Gudikote, J.P., Olivas, O.R., and Wilkinson, M.F. 2002. Boundary-independent polar nonsense-mediated decay. EMBO Rep. 3: 274279.[CrossRef][Medline]
Wilkinson, M.F. 2005. A new function for nonsense-mediated mRNA-decay factors. Trends Genet. 21: 143148.[CrossRef][Medline]
Xie, X., Lu, J., Kulbokas, E.J., Golub, T.R., Mootha, V., Lindblad-Toh, K., Lander, E.S., and Kellis, M. 2005. Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals. Nature 434: 338345.[CrossRef][Medline]
Zhang, Z. and Krainer, A.R. 2004. Involvement of SR proteins in mRNA surveillance. Mol. Cell 16: 597607.[CrossRef][Medline]
Zhang, S., Ruiz-Echevarria, M.J., Quan, Y., and Peltz, S.W. 1995. Identification and characterization of a sequence motif involved in nonsense-mediated mRNA decay. Mol. Cell. Biol. 15: 22312244.[Abstract]
Zhang, J., Sun, X., Qian, Y., LaDuca, J.P., and Maquat, L.E. 1998a. At least one intron is required for the nonsense-mediated decay of triosephosphate isomerase mRNA: A possible link between nuclear splicing and cytoplasmic translation. Mol. Cell. Biol. 18: 52725283.
Zhang, J., Sun, X., Qian, Y., and Maquat, L.E. 1998b. Intron function in the nonsense-mediated decay of ß-globin mRNA: Indications that pre-mRNA splicing in the nucleus can influence mRNA translation in the cytoplasm. RNA 4: 801815.[Abstract]
Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31: 34063415.![]()
CiteULike
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles: