| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Biochemistry, University of Cambridge, Cambridge CB2 1GA, Cambridge, United Kingdom
Reprint requests to: Mark Carrington, Department of Biochemistry, University of Cambridge, 80 Tennis Court Road, Cambridge CB2 1GA, UK; e-mail: mc115{at}cam.ac.uk; fax: 44-1223-766002.
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Keywords: mRNA instability; Trypanosoma brucei; mutagenesis; mRNA regulation
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
; El Sayed et al. 2003; Hall et al. 2003) and are cotranscribed from promoters at the 5' ends of arrays (Johnson et al. 1987; Kooter et al. 1987; Martinez-Calvillo et al. 2003, 2004). Individual mRNAs are monocistronic and are processed from the nascent transcript by two steps: (1) a trans-splicing reaction that adds a 39-nucleotide-long capped mini-exon to the 5' end of the mRNA (LeBowitz et al. 1993; Ullu et al. 1993) and (2) a cleavage and polyadenylation reaction at the 3' end (Matthews et al. 1994; Schürch et al. 1994). The trans-splicing occurs by a reaction similar to cis-splicing (Sutton and Boothroyd 1988), and although the genome contains orthologs of many of the factors required for polyadenylation in crown group eukaryotes (Hendriks et al. 2003), it occurs without recognition of an AAUAAA motif. The trans-splicing and polyadenylation of adjacent genes are linked, with the polyadenylation of one mRNA being dependent on the trans-splicing of the mRNA from the downstream gene (Matthews et al. 1994). With a few exceptions, there does not appear to be clustering of genes into functional cotranscribed units, and mRNAs derived from adjacent genes are usually present at different concentrations in the cell and can show different developmental expression patterns (Clayton 2002). There is no evidence for regulation of RNA polymerase II transcription in trypanosomes (Clayton 2002), and thus the regulation of gene expression must be post-transcriptional for the vast majority of protein coding genes.
Most work aimed at understanding the regulation of gene expression in kinetoplastid protozoa has concentrated on the identification of cis- and trans-acting factors that modulate mRNA half-life. The best characterized cis-acting element is the cycling sequence necessary for the S-phase accumulation of mRNAs encoding proteins involved in chromatin replication in Crithidia fasiculata (Brown and Ray 1997). The mRNA cycling sequence is a discrete octamer occurring once or more per mRNA and can be located in any of the 5' untranslated region (UTR), open reading frame (ORF), 3'UTR or immediately downstream of the polyadenylation site (Mahmood et al. 1999; Avliyakulov et al. 2003). The best defined cis-element involved in the developmental regulation of mRNA levels was identified in the Leishmania mexicana cysteine protease (CPB) gene cluster (Brooks et al. 2001). The element, InS, is 120 nt long and is located downstream of the polyadenylation sites. InS was shown to be necessary and sufficient for the developmental regulation of CPB gene expression by manipulation of the endogenous locus. Two life cycle stages of Trypanosoma brucei are readily cultured and manipulated in the laboratory, the mammalian bloodstream form and the insect procyclic form. The majority of differential gene expression in these two forms arises from developmentally regulated instability of individual mRNA species (Hug et al. 1993; Blattner and Clayton 1995; Hotz et al. 1995; Webb et al. 2005). To date, no short cis-acting element that is necessary and sufficient for developmental regulation of mRNA stability has been identified in trypanosomes. Several mRNAs have been studied to identify cis-acting elements involved in developmentally regulated mRNA stability, and most work has concentrated on the characterization of elements from 3'UTRs that produce an effect on reporter gene expression (Hug et al. 1993; Blattner and Clayton 1995; Hotz et al. 1995; Quijada et al. 2002). The work has identified U-rich elements that shorten mRNA half-life in bloodstream forms (Hotz et al. 1997; Quijada et al. 2002), but it is not clear whether these account for the full degree of differential expression observed for the native mRNA.
Here, a novel strategy is described for the analysis of differentially expressed mRNAs that allows the following: (1) the location of cis-acting elements to the 5'UTR or coding sequence or 3'UTR, (2) an unambiguous and simultaneous determination of whether regions are both necessary and sufficient for regulation, and (3) in the case of unstable mRNAs, a forward genetic analysis to identify loss-of-instability mutants. The strategy has several advantages over existing procedures: (1) alterations are made to the endogenous locus, (2) the selection of mutants is nonpresumptive, and (3) the analysis can be performed more rapidly that existing procedures. The strategy was validated by an analysis of the GPI-PLC mRNA. The GPI-PLC gene encodes a developmentally regulated phospholipase C expressed in bloodstream form but not procyclic form trypanosomes (Bülow and Overath 1985). The GPI-PLC mRNA is 3600 nt with a 2300-base-long 3'UTR (Carrington et al. 1989; Webb et al. 2005) and is unstable in procyclic forms with a half-life of 3 min (Webb et al. 2005). By using the methods outlined above, it was shown that the GPI-PLC 3'UTR contains all the information necessary for differential expression, the first (5') 750 bases of the 3'UTR do not confer full instability in procyclic forms, and deletion of the last (3') 800 bases of the gene results in stability. Such forward genetic analysis for the identification of cis-acting elements is novel in T. brucei and has potential as a rapid method to define further regulatory elements, both cis- and trans-acting. The strategy is applicable to analysis of all eukaryotes using polycistronic transcription and for the identification of a range of cis-acting elements, such as those involved in translational control, in addition to mRNA stability.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
). The strategy described here exploits the very high preference for homologous integration of exogenous DNA into the trypanosome genome (Eid and Sollner-Webb 1991) for the targeted insertion of a construct containing an antibiotic resistance gene and a tubulin inter-ORF sequence either before the initiation codon or after the stop codon of a gene, in this case GPI-PLC (Fig. 1). The inter-ORF sequence donors were 
- and ß-tubulin, which are encoded by a tandem array of 19 alternating - and ß-tubulin genes (Ersfeld et al. 1998). The ß- to -tubulin inter-ORF sequence was used upstream and the - to ß-tubulin inter-ORF sequence downstream of the antibiotic resistance genes (Fig. 1).
|
) the genome now contains two novel genes: one with the endogenous 5'UTR, a hygromycin phosphotransferase (hygR) ORF, and a tubulin 3'UTR; and a second with a tubulin 5'UTR and the endogenous ORF and 3'UTR. In the case where the construct inserts after the stop codon (Fig. 1b), the two novel genes are as follows: one with the endogenous 5'UTR and ORF and a tubulin 3'UTR; and the second with a tubulin 5'UTR, neomycin phosphotransferase (neoR) ORF, and the endogenous 3'UTR. Finally, if both constructs are integrated into the same allele (Fig. 1c), then three novel genes arise: one with the endogenous 5'UTR, a hygR ORF, and a tubulin 3'UTR; the second with the endogenous ORF with tubulin 5' and 3'UTRs; and third with a tubulin 5'UTR, neoR ORF, and the endogenous 3'UTR. Each of the insertions provides two tests: (1) whether the removal of part of the target mRNA results in loss of differential expression, and (2) whether the addition of the same part of the mRNA to a reporter gene results in the reporter acquiring differential expression. Together these tests identify which part of the mRNA contains necessary and sufficient elements.
To test the strategy, a set of insertions was made in bloodstream form trypanosomes to produce the modified GPI-PLC alleles A to E (Fig. 2a). The mRNAs derived from each of the alleles are shown (Fig. 2a) and are labeled with the coding sequence identity (G, GPI-PLC; H, hygR; N, neoR) and allele (wt and A to E). Trypanosomes are diploid so cell lines contained one wild type and one modified allele. The bloodstream form cell lines were then differentiated in vitro to procyclic forms, and the expression of each of the GPI-PLC and antibiotic resistance genes in both the life cycle stages was tested by Northern blotting (Fig. 2b). The GPI-PLC 3'UTR is 2300 bases long (Carrington et al. 1989; Webb et al. 2005), whereas the -tubulin 3'UTR is 125 bases long (see EMBL: BX565803). The difference in length between the two 3'UTRs means that GPI-PLC mRNAs with one or other of the 3'UTRs can be readily distinguished by size on Northern blots.
|
), the wild-type GPI-PLC mRNA (G-wt) was differentially expressed, whereas the GPI-PLC with a tubulin 3'UTR (G-A) was not (Fig. 2b). The addition of the GPI-PLC 3'UTR to the neoR gene conferred differential expression on the mRNA (N-A). In +/B cell lines, there is one wild-type allele and one allele with insertions at both the initiation and stop codon of the GPI-PLC gene. In this case the GPI-PLC mRNA with tubulin 5' and 3'UTRs (G-B) is constitutively expressed, as is the hygR mRNA with the GPI-PLC 5'UTR and tubulin 3'UTR (H-B), whereas the neoR mRNA with the tubulin 5'UTR and the GPI-PLC 3'UTR (N-B) is differentially expressed.
In +/D trypanosomes, there is one wild-type allele and one with an insertion at the GPI-PLC initiation codon; the GPI-PLC mRNA with the tubulin 5'UTR (G-D) is differentially expressed, whereas the neoR mRNA with the GPI-PLC 5'UTR and tubulin 3'UTR (N-D) is constitutively expressed.
The identity of the antibiotic resistance genes in +/E trypanosomes is reversed compared with that of +/B cells. The results are the same in that the mRNA containing the GPI-PLC 3'UTR, hygR in this case (H-E), is differentially expressed whereas the other two mRNAs, neoR with a GPI-PLC 5'UTR and tubulin 3'UTR (N-D) and GPI-PLC with tubulin 5' and 3'UTRs (G-E), are constitutively expressed. The regulation conferred by the different UTRs is independent of the reporter ORF used in these experiments.
The results showed unambiguously that the presence of the GPI-PLC 3'UTR is necessary for differential expression of the GPI-PLC mRNA and that the addition of the GPI-PLC 3'UTR to either a neoR or hygR gene is sufficient to confer differential expression at a similar level to the GPI-PLC mRNA. In contrast, the exchange of the 5'UTR does not affect differential expression of the GPI-PLC gene, and the addition of the GPI-PLC 5'UTR to a reporter gene does not confer developmental expression. The GPI-PLC mRNA with both UTRs exchanged is not differentially expressed, and thus the protein coding sequence alone does not confer developmental regulation.
Alternative mini-exon trans-splicing sites in the GPI-PLC gene
A by-product of the experiments above was the finding of two alternative trans-splicing sites in the GPI-PLC gene. Two distinct GPI-PLC mRNAs were derived from both wild-type and A alleles, differing in size by 350 bases (Fig. 2b, G-wt and G-A), whereas a single mRNA was derived from the B allele (Fig. 2b, G-B). This observation could be explained by the presence alternative mini-exon addition sites in the GPI-PLC 5'UTRs producing mRNAs of different lengths. To test this, RNA from A/C bloodstream form trypanosomes was analyzed. The A/C cells contain one GPI-PLC gene with a tubulin 5'UTR and GPI-PLC 3'UTR, which produces a single mRNA (G-C), and one GPI-PLC gene with a GPI-PLC 5'UTR and a tubulin 3'UTR, which produces two mRNAs (G-A) (Fig. 2b). Thus, the GPI-PLC mRNA doublet is a property of the 5'UTR. When the GPI-PLC 5'UTR was added to the hygR gene (alleles B and C) or the neoR gene (alleles D and E) use of alternative mini-exon addition site was much less pronounced, although detectable (Fig. 2b, N-E). Thus, the degree of alternative splicing was influenced by the coding sequence.
Selection of loss-of-function mutants as revertants to G418 resistance
Trypanosomes with modified GPI-PLC loci were originally made as bloodstream forms. After the initial selection for insertion of the construct, cell lines were grown as bloodstream forms and differentiated to procyclic forms in the absence of antibiotic selection. The regulation conferred upon the neoR or hygR genes by the GPI-PLC 3'UTR paralleled that observed for the endogenous GPI-PLC gene, and no mRNA was detected in the procyclic forms (Fig. 2b). The stringency of the regulation was tested by comparing the sensitivity of GPI-PLC +/+ and +/A procyclic form trypanosomes to G418. In both cases the minimum concentration required to cause cessation of proliferation within 1 d and cell death within a week in DTM:SDM medium was 30 µg/mL.
By using the G418 sensitive +/A procyclic form trypanosomes, a screen for spontaneous revertants to G418 resistance was performed. The screen had two purposes: (1) to screen nonpresumptively for 3'UTR loss-of-function deletants and (2) to test the possibility of using the cell line as a reporter for a mutational screen for trans-acting factors. A set of 25 mL cultures were treated with 30 µg/mL G418 and checked regularly after the apparent death of the culture. Proliferating motile cells were apparent between 18 and 24 d after antibiotic addition. The rate at which revertants arose was ~1 in 3 x 107cells, and the use of 25 mL cultures meant that growth occurred in one in three flasks. Resistant populations were grown on in the presence of G418 for at least three passages, and then the expression of the neoR gene was analyzed by Northern blotting (Fig. 3). In all cases analyzed, there was detectable neoR mRNA in the G418-resistant cell lines, whereas there had been none in the +/A procyclic starting cell line (Fig. 3). Furthermore, each of the resistant populations tested contained a discrete neoR mRNA that was smaller than the neoR mRNA expressed in the bloodstream form of the starting +/A trypanosomes (Fig. 3). The expression of the GPI-PLC mRNA from the A allele was unaffected (Fig. 3). Any mutation was likely to be within the GPI-PLC 3'UTR as the neoR mRNA with the GPI-PLC 3'UTR was truncated in the mutants, and the expression of the GPI-PLC gene in the A allele, immediately upstream of the neoR gene, was unaffected.
|
). Genomic DNA from +/A trypanosomes gave the expected 4.2-kbp PCR product (Fig. 4a). The PCR products from the other mutants varied in size from 0.6 to ~7.5 kbp (Fig. 4b). With the exception of mutant 7 (m7), a single PCR product was consistent with each population arising from a single event, and the variation in the size of the products indicated that the resistant populations had arisen as a result of a range of alterations in the genome. However, the inverse PCR products of >4.2 kbp could not have arisen through a simple deletion within the GPI-PLC 3'UTR.
|
). The remaining deletions were between regions with limited or as little as 6-bp continuous sequence identity.
|
). The deletions in mutants 4 and 5 were much larger (Fig. 5): 10.9 kbp for mutant 4 and 10.0 kbp for mutant 5. The second endpoint of the deletion in mutant 4 was in the intergenic region between the ribosomal protein L44 gene (RPL44) (Tebabi et al. 1990) and the downstream gene; for mutant 5, in the intergenic region between the RPL44 gene and the upstream gene. In both these mutants, at least three genes were deleted, including ß'-COP and two downstream genes encoding polypeptides of unknown function and, in mutant 4, the RPL44 gene. The deletions in mutants 1, 3, 4, and 5 occurred between all the available (TA)n repeats (where n > 8) with the exception of the TA repeat 2.15 kbp after the neoR stop codon (Fig. 5). These four mutants removed most of the GPI-PLC 3'UTR and were of limited use in identifying cis-acting elements. In mutant 7 a duplication of the GPI-PLC and the neoR ORFs had occurred (Fig. 5b), resulting in a neoR gene with a truncated GPI-PLC mRNA containing the first (5') 400 nt of the 3'UTR.
The deletions in mutants 2, 6, and 8 did not occur between (TA) repeats and were more revealing. In mutant 2 the deletion resulted in a loss of 12.7 kbp, removing five genes (Fig. 5). The neoR gene in mutant 2 included the first (5') 0.75 kbp of the GPI-PLC 3'UTR, and the size of the 2200-nt-long neoR mRNA (Fig. 3) indicated that this was transcribed. Therefore, the cis-elements necessary for fully destabilizing the GPI-PLC mRNA lie >750 nt downstream of the stop codon. The deletion in mutant 6 left only the first 0.3 kbp of the 3'UTR in the gene (Fig. 5). In contrast, the deletion in mutant 8 left the first 1.5 kbp of the 3'UTR in the gene, removing only the last (3') 0.8 kbp. The resultant 3'UTR was not sufficient to destabilize the neoR mRNA, consistent with the hypothesis that all necessary cis-elements lie in the last 800 bases of the mRNA. However, this cannot be firmly concluded without an analysis of the mutant neoR mRNA.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
; Furger et al. 1997; Schürch et al. 1997) and has the following advantages: (1) it provides a clear and simultaneous test of necessity and sufficiency, (2) all regions of the mRNA are tested, (3) chimaeric intergenic regions are avoided, and (4) the endogenous locus and promoter are used. The method is generally applicable to kinetoplastid protozoa, which, to date, all have high rates of homologous integration of exogenous DNA. The method was tested by using the GPI-PLC mRNA, which is present in bloodstream trypanosomes but essentially absent in procyclic forms, and it was found that the 3'UTR was responsible for the differential expression. When the GPI-PLC 3'UTR was added to a reporter gene, it conferred a degree of differential expression similar to that found for the GPI-PLC mRNA itself. The replacement of the GPI-PLC 3'UTR with the tubulin 3'UTR resulted in a loss of differential expression (Fig. 3). The presence of a regulatory cis-acting element in the 3'UTR of a differentially expressed mRNA has been reported for several other differentially expressed mRNAs in T. brucei (Hotz et al. 1995; Hug et al. 1993; Blattner and Clayton 1995; Furger et al. 1997; Schürch et al. 1997; Quijada et al. 2002), as well as in T. cruzi (Coughlin et al. 2000) and Leishmania spp. (Ramamoorthy et al. 1995; Charest et al. 1996; Kelly et al. 2001). However, the results in this article are the first to use the endogenous locus to show that the 3'UTR of a mRNA transcribed by RNA polymerase II is necessary and sufficient to confer full differential expression in trypanosomes. From the results presented it is possible that the intergenic region (the sequence between the GPI-PLC polyadenylation site and the mini-exon addition site of the downstream ß'-COP gene) rather than the 3'UTR contains the necessary and sufficient elements for differential expression. The differential expression of isoforms of the CPB cysteine protease genes in L. mexicana are regulated by such an element (Brooks et al. 2001). The deletion in mutant 1 and mutant 3 removed ~0.4 kbp of the intergenic region after the GPI-PLC polyadenylation site, leaving another ~0.45 bp upstream of the ß'-COP mini-exon addition site so any regulatory elements would have to lie within the deleted region.
There is no detectable GPI-PLC protein in procyclic form trypanosomes (Bülow and Overath 1985; Webb et al. 1997), and the mRNA is barely detectable (Carrington et al. 1989). The same regulation was conferred on neoR expression by the GPI-PLC 3'UTR and enabled a genetic screen for spontaneous revertants to G418 resistance to be performed. The screen was successful, and all eight cell lines recovered had undergone a mutation involving the GPI-PLC 3'UTR, resulting in expression of a neoR mRNA. Analysis of the mutants showed that deletion of 0.8 kbp encoding the 3' end of the GPI-PLC mRNA resulted in resistance to G418. This deleted part of the gene contains several AU-rich elements (AREs) as well as several U-rich elements (UREs), both of which have been implicated in regulating mRNA levels (Chen and Shyu 1995; Clayton 2002). However, the remainder of the 3'UTR also contains several potential AREs and UREs, which are clearly insufficient for full instability of the mRNA in procyclic forms. Thus the cis-elements necessary for instability could be more complex than a single element or several elements are required. No small deletions within the GPI-PLC 3'UTR were found. There are two possible reasons for this: (1) such deletions are rare events and so were not present within the limited number of mutants screened to date, or (2) it was necessary to delete a substantial part of the 3'UTR to express sufficient neoR mRNA in procyclic forms.
This type of screen has not been performed in trypanosomes before, and the development of the strategy is important as (1) it is nonpresumptive and (2) it results in the isolation of loss-of-function mutants and identifies functional elements. On a practical level, the rate at which mutants were found (one in 3 x 107) is high enough to make the isolation of mutants a feasible approach, and the characterization of the mutation by inverse PCR was rapid. Overall, the screen was far less time-consuming than a deletion analysis carried out in parallel.
The regulation imposed by the GPI-PLC 3'UTR is very robust; all eight revertants were mutants, and no G418 resistant cells arose without an alteration in the 3'UTR. This raises the exciting possibility that this strategy could be extended further to the production of reporter cell lines for the identification of loss-of-function mutations in trans-acting factors using, for example, transposon mutagenesis (Leal et al. 2004).
The development of such reporter cell lines is important as the use of classical genetic analysis for the identification of mutants in kinetoplastid protozoa is not straightforward. They are diploid, and the absence of reliable and efficient selfing means that the selection of novel mutants in most cellular processes is not practical. Second, performing crosses is difficult in trypanosome species and probably impossible in Leishmania. Third, generating large numbers of progeny is not feasible. A genetic analysis of a pre-existing phenotype is possible (Tait et al. 2002) as is a screen that involves a strong selection for growth of cells with altered cell surfaces to overcome lectin toxicity using chemical mutagenesis (King and Turco 1988), RNAi libraries (Motyka and Englund 2004), and transposon mutagenesis (Leal et al. 2004). Some of these methods are recent and remain to be extensively tested.
In this paper we have described a method that allows the location of necessary and sufficient cis-elements within a mRNA to be unambiguously assigned. The method is appropriate for kinetoplastid protozoa which have high rates of homologous insertion of exogenous DNA and have evolved to use polycistronic transcription of protein coding genes. The approach could be applied in a modified form to other eukayotes, such as nematodes, that also use polycistronic transcription of protein coding genes. The strategy was extended by performing a screen for spontaneous loss of function of the GPI-PLC 3'UTR, the first example of a random mutagenesis screen for factors regulating mRNA stability in trypanosomes.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
) or EATRO 1125 (Van Meirvenne et al. 1975) were used throughout. Lister 427 bloodstream forms expressing VSG MITat 1.5 (MIAG 118) were grown in culture in HMI-9 medium (Hirumi and Hirumi 1994) containing 10% fetal bovine serum, and EATRO 1125 bloodstream forms expressing VSG AnTat1.1 were grown in HMI-9 containing 10 % fetal bovine serum and 0.65% low gelling temperature agarose (Hirumi and Hirumi 1994). In vitro differentiation of bloodstream forms to procyclic forms was performed by using DTM with 15% fetal bovine serum containing 3 mM citrate and 3 mM cis-aconitate at 27°C (Ziegelbauer et al. 1990). Procyclic forms derived in vitro from bloodstream forms were grown initially in DTM (Ziegelbauer et al. 1990). For the genetic screen, procyclic forms were grown in 1:1 (v/v) DTM:SDM-79 (Brun and Schönenberger 1979) containing 10% fetal bovine serum (DTM:SDM). This mixed medium supported growth of procyclic forms to a higher cell density than DTM alone. Procyclic forms were grown at 27°C in sealed flasks.
Transgenic trypanosomes
Transgenic trypanosomes were generated from bloodstream forms using constructs described in the text. The DNA was introduced by electroporation and transformants selected using the appropriate antibiotic: 5 µg/mL hygromycin for expression of the hygR gene or 2.5 µg/mL G418 (geneticin) for expression of the neoR gene. After the initial selection for transgenic cell lines, the antibiotics were omitted during growth of bloodstream forms and for the differentiation to, and growth of, procyclic forms.
Selection of mutants
Log-phase procyclic trypanosomes growing in DTM:SDM were diluted to 2 x 105/mL and grown on to 5 x 105/mL when G418 was added to 30 µg/mL. The cells were split into 25 mL aliquots and placed in 75-cm2 sealed tissue culture flasks and incubated at 27°C.
Cell harvesting
For most experiments cells, typically 10 mL of procyclic form culture at 5 x 106 cells/mL or 100 mL of bloodstream form culture at 5 x 105/mL, were harvested by centrifugation at 1200g for 10 min. The pellet was resuspended in 10 mL phosphate buffered saline, the cells were recovered by centrifugation as before, and the supernatent was removed and the cell pellet lysed in the appropriate buffer from the RNA preparation kit (see below).
RNA analysis
RNA was prepared by using the RNAeasy kit (Qiagen) and analyzed by using vertical agarose gels after denaturing the RNA with glyoxal (McMaster and Carmichael 1977). Northern blotting was as described (Carrington et al. 1987); all blots were washed in 15 mM sodium chloride, 1.5 mM tri-sodium citrate (0.1x SSC), and 0.1% sodium dodecyl sulphate at 60°C.
Inverse PCR
Genomic DNA was digested with HindIII and subsequently purified by using phenol extraction and precipitated by using ethanol. The DNA was redissolved and self-ligated at 10 ng/µL by using T4 DNA ligase. The PCR reaction was carried out by using 100 ng of self-ligated genomic DNA in a 50 µL PCR reaction using Expand DNA polymerase (Roche) and the oligonucleotides 5'cgccatcgccttctatcgcc and 5'GCGTGCAATCCATCTTGTTC, both of which prime outward from inside the neoR ORF (Fig. 4a). The PCR products were either sequenced directly (m5) or after cloning into standard plasmid vectors (m1 to m4 and m6 to m8).
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Received March 7, 2005; accepted April 4, 2005.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONRESULTSDISCUSSIONMATERIALS AND METHODSREFERENCES |
|---|
Avliyakulov, N.K., Hines, J.C., and Ray, D.S. 2003. Sequence elements in both the intergenic spacer and the 3'-untranslated region of the Crithidia fasciculata KAP3 gene are required for cell cycle regulation of KAP3 mRNA. Euk. Cell 2: 671–677.
Blattner, J. and Clayton, C. 1995. The 3' untranslated regions from the Trypanosoma brucei phosphoglycerate kinase-encoding genes mediate developmental regulation. Gene 162: 153–156.[CrossRef][Medline]
Brooks, D.R., Denise, H., Westrop, G.D., Coombs, G.H., and Mottram, J.C. 2001. The stage-regulated expression of Leishmania mexicana CPB cysteine proteases is mediated by an intercistronic sequence element. J. Biol. Chem. 276: 47061–47069.
Brown, L.M. and Ray, D.S. 1997. Cell cycle regulation of RPA1 transcript levels in the trypanosomatid Crithidia fasiculata. Nucleic Acids Res. 25: 3281–3289.
Brun, R. and Schönenberger, M. 1979. Cultivation and in vitro cloning of procyclic culture forms of T. brucei in a semi-defined medium. Acta Tropica 36: 289–292.[Medline]
Bülow, R. and Overath, P. 1985. Synthesis of a hydrolase for the membrane form variant surface glycoprotein is repressed during transformation of Trypanosoma brucei. FEBS Lett. 187: 105–110.[CrossRef][Medline]
Carrington, M., Roditi, I., and Williams, R.O. 1987. The structure and transcription of an element interspersed between tandem arrays of mini-exon donor RNA genes in Trypanosoma brucei. Nucleic Acids Res. 15: 10179–10198.
Carrington, M., Bülow, R., Reinke, H., and Overath, P. 1989. Sequence and expression of the glycosylphosphatidylinositol-specific phospholipase C of Trypanosoma brucei. Mol. Biochem. Parasitol. 33: 289–296.[CrossRef][Medline]
Charest, H., Zhang, W.W., and Matlashewski, G. 1996. The developmental expression of Leishmania donovani A2 amastigote-specific genes is post-transcriptionally mediated and involves elements located in the 3'-untranslated region. J. Biol. Chem. 271: 17081–17090.
Chen, C.Y.A. and Shyu, A.B. 1995. AU-Rich elements: Characterisation and importance in messenger RNA. Trends Biochem. Sci. 20: 465–470.[CrossRef][Medline]
Clayton, C.E. 2002. Life without transcriptional control? From fly to man and back again. EMBO J. 21: 1881–1888.[CrossRef][Medline]
Coughlin, B.C., Teixeira, S.M.R., Kirchhoff, L.V., and Donelson, J.E. 2000. Amastin mRNA abundance in Trypanosoma cruzi is controlled by a 3'-untranslated region position dependent cis-element and an untranslated region binding protein. J. Biol. Chem. 275: 12051–12060.
Cunningham, M.P. and Vickerman, K. 1962. Antigenic analysis in the Trypanosoma brucei group using the agglutination reaction. Trans. R. Soc. Trop. Med. Hyg. 56: 48–59.[CrossRef][Medline]
Eid, J. and Sollner-Webb, B. 1991. Stable integrative transformation of Trypanosoma brucei that occurs exclusively by homologous recombination. Proc. Natl. Acad. Sci. 88: 2118–2121.
El Sayed, N.M., Ghedin, E., Song, J., MacLeod, A., Bringaud, F., Larkin, C., Wanless, D., Peterson, J., Hou, L., Taylor, S., et al. 2003. The sequence and analysis of Trypanosoma brucei chromosome II. Nucleic Acids Res. 31: 4856–4863.
Ersfeld, K., Asbeck, K., and Gull, K. 1998. Direct visualisation of individual gene organisation in Trypanosoma brucei by high-resolution in situ hybridisation. Chromosoma 107: 237–240.[CrossRef][Medline]
Furger, A., Schürch, N., Kurath, U., and Roditi, I. 1997. Elements in the 3' untranslated region of procyclin mRNA regulate expression in insect forms of Trypanosoma brucei by modulating RNA stability and translation. Mol. Cell. Biol. 17: 4372–4380.[Abstract]
Hall, N., Berriman, M., Lennard, N.J., Harris, B.R., Hertz-Fowler, C., Bart-Delabesse, E.N., Gerrard, C.S., Atkin, R.J., Barron, A.J., Bowman, S., et al. 2003. The DNA sequence of chromosome I of an African trypanosome: Gene content, chromosome organisation, recombination and polymorphism. Nucleic Acids Res. 31: 4864–4873.
Hendriks, E.F., Abdul-Razak, A., and Matthews, K.R. 2003. tbCPSF30 depletion by RNA interference disrupts polycistronic RNA processing in Trypanosoma brucei. J. Biol. Chem. 278: 26870–26878.
Hirumi, H. and Hirumi, K. 1994. Axenic culture of African trypanosome bloodstream forms. Parasitol. Today 10: 80–84.[CrossRef][Medline]
Hotz, H.R., Lorenz, P., Fischer, R., Krieger, S., and Clayton, C. 1995. Role of 3'-untranslated regions in the regulation of hexose transporter mRNAs in Trypanosoma brucei. Mol. Biochem. Parasitol. 75: 1–14.[CrossRef][Medline]
Hotz, H.R., Hartmann, C., Huober, K., Hug, M., and Clayton, C. 1997. Mechanisms of developmental regulation in Trypanosoma brucei: A polypyrimidine tract in the 3'-untranslated region of a surface protein mRNA affects RNA abundance and translation. Nucleic Acids Res. 15: 3017–3025.
Hug, M., Carruthers, V.B., Hartmann, C., Sherman, D.S., Cross, G.A.M., and Clayton, C. 1993. A possible role for the 3'-untranslated region in developmental regulation in Trypanosoma brucei. Mol. Biochem. Parasitol. 61: 87–96.[CrossRef][Medline]
Johnson, P.J., Kooter, J.M., and Borst, P. 1987. Inactivation of transcription by UV irradiation of T. brucei provides evidence for a multicistronic transcription unit including a VSG gene. Cell 51: 273–281.[CrossRef][Medline]
Kelly, B.L., Nelson, T.N., and McMaster, W.R. 2001. Stage-specific expression in Leishmania conferred by 3' untranslated regions of L. major leishmanolysin genes (GP63). Mol. Biochem. Parasitol. 116: 101–104.[CrossRef][Medline]
King, D.L. and Turco, S.J. 1988. A ricin agglutinin-resistant clone of Leishmania donovani deficient in lipophosphoglycan. Mol. Biochem. Parasitol. 28: 285–293.[CrossRef][Medline]
Kooter, J.M., Van der Spek, H.J., Wagter, R., d’Oliviera, C.E., Van der Hoeven, F., Johnson, P.J., and Borst, P. 1987. The anatomy and transcription of a telomeric expression site for variant specific surface antigens in Trypanosoma brucei. Cell 51: 261–272.[CrossRef][Medline]
Leal, S., Acosta-Serrano, A., Morris, J., and Cross, G.A.M. 2004. Transposon mutagenesis of Trypanosoma brucei Identifies glycosylation mutants resistant to concanavalin A. J. Biol. Chem. 279: 28979–28988.
LeBowitz, J.H., Smith, H.Q., Rusche, L., and Beverley, S.M. 1993. Coupling of poly(A) site selection and trans-splicing in Leishmania. Genes & Dev. 7: 996–1007.
Mahmood, R., Hines, J.C., and Ray, D.S. 1999. Identification of cis and trans elements involved in the cell cycle regulation of multiple genes in Crithidia fasiculata. Mol. Cell. Biol. 19: 6174–6182.
Maier, A.G., Webb, H., Ding, M., Bremser, M., Carrington, M., and Clayton, C. 2001. The coatomer of Trypanosoma brucei. Mol. Biochem. Parasitol. 115: 55–61.[CrossRef][Medline]
Martinez-Calvillo, S., Yan, S., Nguyen, D., Fox, M., Stuart, K., and Myler, P.J. 2003. Transcription of Leishmania major Friedlin chromosome 1 initiates in both directions within a single region. Mol. Cell 11: 1291–1299.[CrossRef][Medline]
Martinez-Calvillo, S., Nguyen, D., Stuart, K., and Myler, P.J. 2004. Transcription initiation and termination on Leishmania major chromosome 3. Eukaryot. Cell 3: 506–517.
Matthews, K.R., Tschudi, C., and Ullu, E. 1994. A common pyrimidine-rich motif governs trans-splicing and polyadenylation of tubulin polycistronic pre-mRNA in trypanosomes. Genes & Dev. 8: 491–501.
McDonagh, P.D., Myler, P.J., and Stuart, K. 2000. The unusual gene organisation of Leishmania major chromosome 1 may reflect novel transcription processes. Nucleic Acids Res. 28: 2800–2803.
McMaster, G.K. and Carmichael, G.G. 1977. Analysis of single- and double-stranded nucleic acids on polyacrylamide and agarose gels by using glyoxal and acridine orange. Proc. Natl. Acad. Sci. 74: 4835–4838.
Motyka, S.A. and Englund, P.T. 2004. RNA interference for analysis of gene function in trypanosomatids. Curr. Opin. Microbiol. 7: 362–368.[CrossRef][Medline]
Quijada, L., Hartmann, C., Guerra-Giraldez, C., Drozdz, M., Irmer, H., and Clayton, C. 2002. Expression of the human RNA-binding protein HuR in Trypanosoma brucei induces differentiation-related changes in the abundance of developmentally regulated mRNAs. Nucleic Acids Res. 30: 1–11.
Ramamoorthy, R., Swihart, K.G., McCoy, J.J., Wilson, M.E., and Donelson, J.E. 1995. Intergenic regions between tandem gp63 genes influence the differential expression of gp63 RNAs in Leishmania chagasi promastigotes. J. Biol. Chem. 270: 12133–12139.
Schürch, N., Hehl, A., Vassella, E., Braun, R., and Roditi, I. 1994. Accurate polyadenylation of procyclin mRNAs in Trypanosoma brucei is determined by pyrimidine-rich elements in the intergenic regions. Mol. Cell. Biol. 14: 3668–3675.
Schürch, N., Furger, A., Kurath, U., and Roditi, I. 1997. Contributions of the procyclin 3' untranslated region and coding region to the regulation of expression in bloodstream forms of Trypanosoma brucei. Mol. Biochem. Parasitol. 89: 109–121.[CrossRef][Medline]
Sutton, R.E. and Boothroyd, J.C. 1988. Trypanosome trans splicing utilizes 2'-5' branches and a corresponding debranching activity. EMBO J. 7: 1431–1437.[Medline]
Tait, A., Masiga, D., Ouma, J., MacLeod, A., Sasse, J., Melville, S., Lindegard, G., McIntosh, A., and Turner, M. 2002. Genetic analysis of phenotype in Trypanosoma brucei: A classical approach to potentially complex traits. Philos. Trans. R. Soc. Lond. B Biol. Sci. 357: 89–99.[CrossRef][Medline]
Tebabi, P., Halleux, S., and Pays, E. 1990. Nucleotide sequence of a full-length cDNA coding for the ribosomal L44 protein of Trypanosoma brucei. Nucleic Acids Res. 18: 2809.
Ullu, E., Matthews, K.R., and Tschudi, C. 1993. Temporal order of RNA-processing reactions in trypanosomes: rapid trans splicing precedes polyadenylation of newly synthesised tubulin transcripts. Mol. Cell. Biol. 13: 720–725.
Van Meirvenne, N., Jansen, P., and Magnus, E. 1975. Antigenic varition in syringe-passaged populations of Trypanosoma (Trypanozoon) brucei. Ann. Soc. Belge. Med Trop. 55: 1–23.[Medline]
Webb, H., Carnall, N., Vanhamme, L., Rolin, S., Van Den Abbeele, J., Welburn, S., Pays, E., and Carrington, M. 1997. The GPI-phospholipase C of Trypanosoma brucei is non-essential but influences parasitaemia in mice. J. Cell. Biol. 139: 103–114.
Webb, H., Burns, R., Ellis, L., Kimblin, N., and Carrington, M. 2005. Developmentally regulated instability of the GPI-PLC mRNA is dependent on a short lived protein factor. Nucleic Acids Res. 33: 1503–1512.
Ziegelbauer, K., Quinten, M., Schwarz, H., Pearson, T., and Overath, P. 1990. Synchronous differentiation of Trypanosoma brucei from bloodstream to procyclic forms in vitro. Eur. J. Biochem. 192: 373–378.[Medline]
CiteULike 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
